Prev. | NRCD Clone C | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP09053

HP ID(1) HP09053
Gene ID(2)
Gene Symbol finder C3orf26(exon 1, antisense)
Protein Name Transcribed locus
RefSeq
Length of RefSeq (bp)
Chromosome 3q12.1
Reference DDBJ accession
UniGene Hs.581320

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBdS081C21 pGCAP10 GAAACGGCTAAGTAAGACAGAATGAGTGTGGCCTACTGAGGAACAGAATGAAGGCTGGTG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl