Prev. | NRCD Clone K | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP09039

HP ID(1) HP09039
Gene ID(2) 84530
Gene Symbol finder KIAA1853
Protein Name KIAA1853
RefSeq NM_194286.2
Length of RefSeq (bp) 8382
Chromosome 12q24.23
Reference DDBJ accession
UniGene Hs.112577

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBdS075I18 pGCAP10 GGCGCACGCACACACATCCGACCCTGTCGCCTCTTCTCTCCTGGTGCTGCCCAGAAAGCC
RBdS187B17 pGCAP10 GGCGCACGCACACACATCCGACCCTGTCGCCTCTTCTCTCCTGGTGCTGCCCAGAAAGCC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl