Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP09032

HP ID(1) HP09032
Gene ID(2) 8863
Gene Symbol finder PER3
Protein Name period homolog 3 (Drosophila)
RefSeq NM_016831.1
Length of RefSeq (bp) 6203
Chromosome 1p36.23
Reference DDBJ accession
UniGene Hs.162200

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBdS075G05 pGCAP10 GGCCCCAGGGCCAATGGAGGCCTGCGGAGTCGGCCCCGACGACCAATCGCGCGGCCCGGG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl