Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP09029

HP ID(1) HP09029
Gene ID(2)
Gene Symbol finder PYGO2(exon 1, antisense)
Protein Name
RefSeq
Length of RefSeq (bp)
Chromosome 1q21.3
Reference DDBJ accession
UniGene

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBdS075F06 pGCAP10 GGGGGGCGGCGCCGAGGCGGCCATGGAGTGGGGGACCCGGGTTAGCGGCAGCGGCGGGGG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl