Prev. | NRCD Clone K | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP09002

HP ID(1) HP09002
Gene ID(2) 84861
Gene Symbol finder KLHL22
Protein Name kelch-like 22 (Drosophila)
RefSeq NM_032775.2
Length of RefSeq (bp) 2602
Chromosome 22q11.21
Reference DDBJ accession
UniGene Hs.517419

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBdS070F05 pGCAP10 TGAGCTGCGAGTGCGGCCTCGGCTGGCGGCGGCACCAGGATGGCAGAGGAGCAGGAGTTC
RBdS187G06 pGCAP10 TGGAGCTGCGAGTGCGGCCTCGGCTGGCGGCGGCACCAGGCCACAGTTGTAAGGGATCTT

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl