Prev. | NRCD Clone T | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP08991

HP ID(1) HP08991
Gene ID(2) 27037
Gene Symbol finder TRMT2A
Protein Name TRM2 tRNA methyltransferase 2 homolog A (S. cerevisiae)
RefSeq NM_022727.4
Length of RefSeq (bp) 2917
Chromosome 22q11.1-22q13; 22q11.21
Reference DDBJ accession
UniGene Hs.713579

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBdS051N13 pGCAP10 GGGCCTCCGCCGCACGCGCTGGCGGACTAAGAGTGGCTGGCGAAGCGAGCGGCCGGCGCG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl