Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP08964

HP ID(1) HP08964
Gene ID(2) 5383
Gene Symbol finder PMS2L5
Protein Name postmeiotic segregation increased 2-like 5
RefSeq NM_174930.3
Length of RefSeq (bp) 748
Chromosome 7q11-q22
Reference DDBJ accession
UniGene Hs.647025

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBdS040M13 pGCAP10 GGTGGAGGGCACTTTCCCAGTCCCCGAGGCGGATCCGGTGTTGCATCCTTGGAGAGAGCT

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl