Prev. | NRCD Clone K | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP08961

HP ID(1) HP08961
Gene ID(2) 170850
Gene Symbol finder KCNG3
Protein Name potassium voltage-gated channel, subfamily G, member 3
RefSeq NM_133329.4
Length of RefSeq (bp) 3824
Chromosome 2p21
Reference DDBJ accession
UniGene Hs.352633

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBdS040K14 pGCAP10 GTCACTTTGCCTCTCGCCTCTGGACGGCGGCGGGGCGGCCGCCGGATTCGCGGCCGCAGG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl