Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP08952

HP ID(1) HP08952
Gene ID(2) 5514
Gene Symbol finder PPP1R10
Protein Name protein phosphatase 1, regulatory (inhibitor) subunit 10
RefSeq NM_002714.2
Length of RefSeq (bp) 4540
Chromosome 6p21.3
Reference DDBJ accession
UniGene Hs.106019

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBdS040E18 pGCAP10 GATTCTGGGGTTCGTTTAGAGGTTTGAATTTTCTCGGAGAAAGACAGGCCGGCCACGAGG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl