Prev. | NRCD Clone T | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP08935

HP ID(1) HP08935
Gene ID(2) 55654
Gene Symbol finder TMEM127
Protein Name transmembrane protein 127
RefSeq NM_017849.1
Length of RefSeq (bp) 4223
Chromosome 2q11.2
Reference DDBJ accession
UniGene Hs.355708

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBdS022L09 pGCAP10 GAGGAGGAAGCCGGAAGTGCATCGGCCCCGGGTCTGTCCGGGCGTTGCGGGATTGGGGCC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl