Prev. | NRCD Clone B | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP08914

HP ID(1) HP08914
Gene ID(2) 641
Gene Symbol finder BLM
Protein Name Bloom syndrome, RecQ helicase-like
RefSeq NM_000057.2
Length of RefSeq (bp) 4528
Chromosome 15q26.1
Reference DDBJ accession
UniGene Hs.716515

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBdS022A13 pGCAP10 TGGAATCGGAATAGGCAAGCTTCCGGCGGGAAGTGAGCCAGGGCTTGGCGCGGCGGCCGT

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl