Prev. | NRCD Clone N | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP08913

HP ID(1) HP08913
Gene ID(2) 57122
Gene Symbol finder NUP107
Protein Name nucleoporin 107kDa
RefSeq NM_020401.2
Length of RefSeq (bp) 3158
Chromosome 12q15
Reference DDBJ accession
UniGene Hs.524574

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBdS022A08 pGCAP10 GGCGGTAGCTAAACTGCAGCCAACTTTGGTTGTGTGTGGAAAAGGCTTTAGCCATGGACA

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl