Prev. | NRCD Clone C | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP08912

HP ID(1) HP08912
Gene ID(2) 83606
Gene Symbol finder C22orf13
Protein Name chromosome 22 open reading frame 13
RefSeq NM_031444.2
Length of RefSeq (bp) 3619
Chromosome 22q11.2
Reference DDBJ accession
UniGene Hs.9850

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBdS022A05 pGCAP10 GGGTGGCGGAGAAGGAACTCGACACGCACCGACCGCCCTCCCGCCCCAGCCGAAGCGGAA

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl