Prev. | NRCD Clone U | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP08907

HP ID(1) HP08907
Gene ID(2) 5412
Gene Symbol finder UBL3
Protein Name ubiquitin-like 3
RefSeq NM_007106.3
Length of RefSeq (bp) 4355
Chromosome 13q12-q13
Reference DDBJ accession
UniGene Hs.145575

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBdS015N03 pGCAP10 GCCCCGTTTCCCTTAGTCGCACTCAGGCAGCCGCCGCCGCCGCCGCTGCCGCTGCCGCCA

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl