Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP08905

HP ID(1) HP08905
Gene ID(2) 29990
Gene Symbol finder PILRB
Protein Name paired immunoglobin-like type 2 receptor beta
RefSeq NM_013440.3
Length of RefSeq (bp) 3632
Chromosome 7q22.1
Reference DDBJ accession
UniGene Hs.632314

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBdS015M02 pGCAP10 GAGTCGCCCTCCGTCGTGGCCTGGCGTGGATTCCGAGCGTTGGTGTCTGGCGGTTTCCGA

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl