Prev. | NRCD Clone K | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP08879

HP ID(1) HP08879
Gene ID(2) 79070
Gene Symbol finder KDELC1
Protein Name KDEL (Lys-Asp-Glu-Leu) containing 1
RefSeq NM_024089.2
Length of RefSeq (bp) 2129
Chromosome 13q33
Reference DDBJ accession
UniGene Hs.408629

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBdS014M15 pGCAP10 GAGTGGCAGGAGCAACTCAAGTTCATCATTGTCCTGAGAGAGAGGAGCAGCGCGGTTCTC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl