Prev. | NRCD Clone C | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP08855

HP ID(1) HP08855
Gene ID(2)
Gene Symbol finder C12orf35(upstream, opposite)
Protein Name
RefSeq
Length of RefSeq (bp)
Chromosome 12p11.21
Reference DDBJ accession
UniGene

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBdS013J14 pGCAP10 GGCAGATAACACCCGGGCTTGCAGAGCGCTTTCATCTGCCCGACGCGGAAATCTCCTGCA

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl