Prev. | NRCD Clone N | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP08854

HP ID(1) HP08854
Gene ID(2) 266812
Gene Symbol finder NAP1L5
Protein Name nucleosome assembly protein 1-like 5
RefSeq NM_153757.2
Length of RefSeq (bp) 1965
Chromosome 4q22.1
Reference DDBJ accession
UniGene Hs.12554

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBdS013J02 pGCAP10 GGTCATTCCCGCGGCCGCACGTCACCGCCACTTGCCGCATCCGCAAGATCTCTCTGGACC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl