Prev. | NRCD Clone T | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP08837

HP ID(1) HP08837
Gene ID(2) 84283
Gene Symbol finder TMEM79
Protein Name transmembrane protein 79
RefSeq NM_032323.2
Length of RefSeq (bp) 2215
Chromosome 1q22
Reference DDBJ accession
UniGene Hs.347408

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBdS007P07 pGCAP10 GGGGCAGCATGGCGTCTTTCCGGCTTCTCCAAACCCTTGCGAAAAACTTTATTGGCAAAG
RBdS177H16 pGCAP10 GGGGAAGTTGCCAGAACTAACTCTGGGCAGCATGGCTCTTTCCGGCTTCTCCAAACCCTT

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl