Prev. | NRCD Clone B | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP08833

HP ID(1) HP08833
Gene ID(2) 571
Gene Symbol finder BACH1
Protein Name BTB and CNC homology 1, basic leucine zipper transcription factor 1
RefSeq NM_001011545.1
Length of RefSeq (bp) 2743
Chromosome 21q22.11
Reference DDBJ accession
UniGene Hs.154276

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBdS007L24 pGCAP10 GGCGCTCTCGCTTCAGTCAGTCGGGCCGCGCCGCGCCTCAGCTCTGCAAAAGACTGTTGA

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl