Prev. | NRCD Clone O | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP08822

HP ID(1) HP08822
Gene ID(2)
Gene Symbol finder ODC1(upstream, opposite)
Protein Name
RefSeq
Length of RefSeq (bp)
Chromosome 2p25.1
Reference DDBJ accession
UniGene

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBdS007G24 pGCAP10 TGCCCGGCCCGCGGCAGCTGAACGGCAGAGCCTGTAGCTGCACAGCTGTGCTTCCACCTG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl