Prev. | NRCD Clone T | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP08820

HP ID(1) HP08820
Gene ID(2) 26092
Gene Symbol finder TOR1AIP1
Protein Name torsin A interacting protein 1
RefSeq NM_015602.2
Length of RefSeq (bp) 3824
Chromosome 1q24.2
Reference DDBJ accession
UniGene Hs.496459

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBdS007G19 pGCAP10 TGTCTGCGAAAGAGGAAGTGAGAGAAAGCGCGTACTACCTTCGGTCTAGGCAGCGGAGGC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl