Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP08819

HP ID(1) HP08819
Gene ID(2) 11044
Gene Symbol finder POLS
Protein Name polymerase (DNA directed) sigma
RefSeq NM_006999.3
Length of RefSeq (bp) 3861
Chromosome 5p15
Reference DDBJ accession
UniGene Hs.481542

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBdS007G13 pGCAP10 GGCCGCCGCCGCCGCCGCCGCAGGAGCGCCGAGCCAGCGGCGCGAGCGTGACTGAGGGCT

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl