Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP08814

HP ID(1) HP08814
Gene ID(2) 133522
Gene Symbol finder PPARGC1B
Protein Name peroxisome proliferator-activated receptor gamma, coactivator 1 beta
RefSeq NM_133263.2
Length of RefSeq (bp) 3277
Chromosome 5q33.1
Reference DDBJ accession
UniGene Hs.591261

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBdS007F07 pGCAP10 GGGGCCGGCTCGGCGTTGACTCCGCCGCACGCTGCAGCCGCGGCTGGAAGATGGCGGGGA

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl