Prev. | NRCD Clone U | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP08810

HP ID(1) HP08810
Gene ID(2) 51118
Gene Symbol finder UTP11L
Protein Name UTP11-like, U3 small nucleolar ribonucleoprotein, (yeast)
RefSeq NM_016037.3
Length of RefSeq (bp) 2067
Chromosome 1p34.3
Reference DDBJ accession
UniGene Hs.472038

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBdS007D24 pGCAP10 GGGACTTGGCGGCAGAGGCAGTGCGGATCCGGCGTTCTCCACTGATCTTTTCCAAGGCTG
RBdS177N19 pGCAP10 GAGNGGACTTGGNGGCNGANGCANTGCGGATCCGGCGTTCTCCACTGATCTTTTCCAAGG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl