Prev. | NRCD Clone T | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP08793

HP ID(1) HP08793
Gene ID(2) 51078
Gene Symbol finder THAP4
Protein Name THAP domain containing 4
RefSeq NM_015963.4
Length of RefSeq (bp) 2175
Chromosome 2q37.3
Reference DDBJ accession
UniGene Hs.435759

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBd99B06 pGCAP10 GCGGCGGGCGGCTGGGGCCGGGGCCTGGCTGCGCGGATGGGCCAAGGNCCGCGATGATCA

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl