Prev. | NRCD Clone T | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP08769

HP ID(1) HP08769
Gene ID(2)
Gene Symbol finder TAF4(upstream, opposite)
Protein Name Transcribed locus
RefSeq
Length of RefSeq (bp)
Chromosome 20q13.33
Reference DDBJ accession
UniGene Hs.636386

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBd96C10 pGCAP10 GGCGCCCACGAAGGGGGGCGTCTGGATGACAGTGCCGGGGGCGGCGGGCTTGGGCAGCGG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl