Prev. | NRCD Clone K | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP08767

HP ID(1) HP08767
Gene ID(2) 23392
Gene Symbol finder KIAA0368
Protein Name KIAA0368
RefSeq NM_001080398.1
Length of RefSeq (bp) 7391
Chromosome 9q31.3
Reference DDBJ accession
UniGene Hs.368255

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBd95H12 pGCAP10 GGCCGCGTGTCGAGTCCGCGCGGGGAGCGCACGCGGGGCGGGCGGCGACAGATCAGCTTG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl