Prev. | NRCD Clone O | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP08765

HP ID(1) HP08765
Gene ID(2) 79629
Gene Symbol finder OCEL1
Protein Name occludin/ELL domain containing 1
RefSeq NM_024578.1
Length of RefSeq (bp) 1124
Chromosome 19p13.11
Reference DDBJ accession
UniGene Hs.422676

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBd95F08 pGCAP10 GATCCTGCAGTAAATGCACAACCCGGACGGAAGTGCCTCTCCGACAGCAGATCCAGGCTC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl