Prev. | NRCD Clone B | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP08761

HP ID(1) HP08761
Gene ID(2)
Gene Symbol finder BSG(intron, opposite)
Protein Name Transcribed locus
RefSeq
Length of RefSeq (bp)
Chromosome 19p13.3
Reference DDBJ accession
UniGene Hs.661717

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBd95A07 pGCAP10 GATCCCACGCAGGCAGCCCCCTTCCGTACAAGTAAAGTGGTCTCGCTGAGAAAAAAAAAA

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl