Prev. | NRCD Clone J | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP08751

HP ID(1) HP08751
Gene ID(2) 8242
Gene Symbol finder JARID1C
Protein Name jumonji, AT rich interactive domain 1C
RefSeq NM_004187.2
Length of RefSeq (bp) 6727
Chromosome Xp11.22-p11.21
Reference DDBJ accession
UniGene Hs.631768

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBd93F02 pGCAP10 GGGTGTGGGGAGGGGAGACGCTGACAAACCAAGATGGCGGCGGCGGCGCTGAAGGCCGCG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl