Prev. | NRCD Clone C | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP08748

HP ID(1) HP08748
Gene ID(2) 84298
Gene Symbol finder C12orf31
Protein Name chromosome 12 open reading frame 31
RefSeq NM_032338.2
Length of RefSeq (bp) 1230
Chromosome 12q14.3
Reference DDBJ accession
UniGene Hs.504820

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBd92F05 pGCAP10 CGGCCGGCCGATGACTTCCGGTCGGCGTGAGCGTGAGGTGTGGGTGTTCGTTTCTCAGGT

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl