Prev. | NRCD Clone T | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP08745

HP ID(1) HP08745
Gene ID(2) 7008
Gene Symbol finder TEF
Protein Name thyrotrophic embryonic factor
RefSeq NM_003216.2
Length of RefSeq (bp) 4382
Chromosome 22q13.2
Reference DDBJ accession
UniGene Hs.181159

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBd92C11 pGCAP10 GAGTAGCTGCCCGTGTCGGCAGCTGCAGCGGGTCGCACGGCTCCGGCCCATCTCGGGGGG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl