Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP08737

HP ID(1) HP08737
Gene ID(2) 55170
Gene Symbol finder PRMT6
Protein Name protein arginine methyltransferase 6
RefSeq NM_018137.1
Length of RefSeq (bp) 2506
Chromosome 1p13.3
Reference DDBJ accession
UniGene Hs.26006

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBd91F03 pGCAP10 TGGGGGAGCCGGGCAGAGCGGCCAAGATGTCGCAGCCCAAGAAAAGAAAGCTTGAGTCGG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl