Prev. | NRCD Clone K | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP08715

HP ID(1) HP08715
Gene ID(2) 3796
Gene Symbol finder KIF2A
Protein Name kinesin heavy chain member 2A
RefSeq NM_004520.3
Length of RefSeq (bp) 3260
Chromosome 5q12-q13
Reference DDBJ accession
UniGene Hs.558351

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBd88H01 pGCAP10 GACTCTACCCCGCGCCGTCTCACGGCCCCGGCCCTAGCTTCACCCCGACTACCCGGCGTG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl