Prev. | NRCD Clone T | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP08698

HP ID(1) HP08698
Gene ID(2) 80764
Gene Symbol finder THAP7
Protein Name THAP domain containing 7
RefSeq NM_001008695.1
Length of RefSeq (bp) 1097
Chromosome 22q11.2
Reference DDBJ accession
UniGene Hs.512756

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBd86A12 pGCAP10 GATGCGCTAGTTGTTGCTCGCCTCGGGTCGCAACTGCGTAGAGGCTTCGCGCCTTTCTCA

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl