Prev. | NRCD Clone N | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP08691

HP ID(1) HP08691
Gene ID(2) 79661
Gene Symbol finder NEIL1
Protein Name nei endonuclease VIII-like 1 (E. coli)
RefSeq NM_024608.1
Length of RefSeq (bp) 1828
Chromosome 15q24.2
Reference DDBJ accession
UniGene Hs.512732

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBd84C07 pGCAP10 GACACGTCGGGTTTCCTCGTTTTTGCGGACTGGCGCTTTCTGATTTCAGAGACTCTCCGC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl