Prev. | NRCD Clone T | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP08684

HP ID(1) HP08684
Gene ID(2)
Gene Symbol finder TFDP1(intron 1, opposite)
Protein Name no EST
RefSeq
Length of RefSeq (bp)
Chromosome 13q34
Reference DDBJ accession
UniGene

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBd83C09 pGCAP10 GCCACCTGGGCACAGCCCCGGGGTCCCGGCGCAACGTGCAGGCTCGCGGCGTCCACCCCA

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl