Prev. | NRCD Clone K | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP08680

HP ID(1) HP08680
Gene ID(2) 3757
Gene Symbol finder KCNH2
Protein Name potassium voltage-gated channel, subfamily H (eag-related), member 2
RefSeq NM_000238.2
Length of RefSeq (bp) 3900
Chromosome 7q35-q36
Reference DDBJ accession
UniGene Hs.647099

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBd82H08 pGCAP10 TGgCaGGCGCTGCCCGAGCCGCGGGCGCTGGAGCGGCTGTCGGCGCGGTGGCAGGCGGGA
RBdS154O04 pGCAP10 GAGGCGCTGCCCGAGCCGCGGGCGCTGGAGCGGCTGTCGGCGCGGTGGCAGGCGGGAGCC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl