Prev. | NRCD Clone C | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP08677

HP ID(1) HP08677
Gene ID(2) 84553
Gene Symbol finder C6orf168
Protein Name chromosome 6 open reading frame 168
RefSeq NM_032511.2
Length of RefSeq (bp) 9773
Chromosome 6q16.2-q16.3
Reference DDBJ accession
UniGene Hs.573245

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBd82E03 pGCAP10 GGGGGCCCGCGGGAGGGGCTGGAGCGCAGGCGGAGGGCCGGCCGGGGTAGGGGAGGACCG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl