Prev. | NRCD Clone W | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP08665

HP ID(1) HP08665
Gene ID(2) 91833
Gene Symbol finder WDR20
Protein Name WD repeat domain 20
RefSeq NM_144574.2
Length of RefSeq (bp) 2423
Chromosome 14q32.31
Reference DDBJ accession
UniGene Hs.36859

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBd80D08 pGCAP10 GAACGCTGCTTTCCAAGATGGCGACGGAGGGAGGAGGGAAGGAGATGAACGAGATTAAGA

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl