Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP08650

HP ID(1) HP08650
Gene ID(2) 9487
Gene Symbol finder PIGL
Protein Name phosphatidylinositol glycan anchor biosynthesis, class L
RefSeq NM_004278.3
Length of RefSeq (bp) 1163
Chromosome 17p12-p11.2
Reference DDBJ accession
UniGene Hs.499793

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBd77H04 pGCAP10 GGCTGCTTACCCATCATGGAAGCAATGTGGCTCCTGTGTGTGGCGTTGGCGGTCTTGGCA

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl