Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP08649

HP ID(1) HP08649
Gene ID(2) 51422
Gene Symbol finder PRKAG2
Protein Name protein kinase, AMP-activated, gamma 2 non-catalytic subunit
RefSeq NM_016203.3
Length of RefSeq (bp) 3423
Chromosome 7q36.1
Reference DDBJ accession
UniGene Hs.647072

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBd77H02 pGCAP10 GAGAAAGGAGGACGGACCCAGCTGCAGGCTCCGAGCTGGTTTATTCTGCGGCCGAGGATT

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl