Prev. | NRCD Clone C | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP08644

HP ID(1) HP08644
Gene ID(2) 56997
Gene Symbol finder CABC1
Protein Name chaperone, ABC1 activity of bc1 complex homolog (S. pombe)
RefSeq NM_020247.4
Length of RefSeq (bp) 2932
Chromosome 1q42.13
Reference DDBJ accession
UniGene Hs.118241

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBd76H02 pGCAP10 GGTTGGTAAACAGATCCGGAGCGCGTGGCGGGCGTCAGCGCGGTGGCCAGCGCGCAGAGG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl