Prev. | NRCD Clone K | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP08639

HP ID(1) HP08639
Gene ID(2) 114818
Gene Symbol finder KLHL29
Protein Name kelch-like 29 (Drosophila)
RefSeq XM_001717454.1
Length of RefSeq (bp) 5386
Chromosome 2p24.1
Reference DDBJ accession
UniGene Hs.130593

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBd75H10 pGCAP10 AGGTGCGCGCCTCTGTGCAGCGAGAAGCCAGGTTGGGGTTTTCTGCCCCTCGCGTCCTCT

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl