Prev. | NRCD Clone T | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP08635

HP ID(1) HP08635
Gene ID(2) 85378
Gene Symbol finder TUBGCP6
Protein Name tubulin, gamma complex associated protein 6
RefSeq NM_001008658.1
Length of RefSeq (bp) 6275
Chromosome 22q13.31-q13.33
Reference DDBJ accession
UniGene Hs.336431

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBd75B06 pGCAP10 GGACGCGACGGAGGCGGCGAGAGCGGCAGCCGTGGGCACTTTCCACGGGTGAGGCCTGGA

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl