Prev. | NRCD Clone T | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP08608

HP ID(1) HP08608
Gene ID(2) 220359
Gene Symbol finder TIGD3
Protein Name tigger transposable element derived 3
RefSeq NM_145719.2
Length of RefSeq (bp) 1980
Chromosome 11q13.1
Reference DDBJ accession
UniGene Hs.632121

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBd71E06 pGCAP10 GGAGAGCCCGGCGCGGGCGGCGCGCACGGGACTCTGCTGTGCGCGCGCCCGCCCGCCCGC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl