Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP08595

HP ID(1) HP08595
Gene ID(2) 57475
Gene Symbol finder PLEKHH1
Protein Name pleckstrin homology domain containing, family H (with MyTH4 domain) member 1
RefSeq NM_020715.2
Length of RefSeq (bp) 6540
Chromosome 14q24.1
Reference DDBJ accession
UniGene Hs.594236

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBd70C12 pGCAP10 GCGGCGGCAGCCCGGGACTCCGGCGAGAGCGACGCAGGGTCGGCCTGCGGNGGGCGGGCC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl