Prev. | NRCD Clone Y | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP08550

HP ID(1) HP08550
Gene ID(2)
Gene Symbol finder YTHDF1(upstream, opposite)
Protein Name
RefSeq
Length of RefSeq (bp)
Chromosome 20q13.33
Reference DDBJ accession
UniGene

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBd63G03 pGCAP10 GGTACAGCCGCCCACACACACCCCGGCCACAGCCGCACCCCCGACGCGCTACCGGCACTG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl