Prev. | NRCD Clone T | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP08543

HP ID(1) HP08543
Gene ID(2) 55092
Gene Symbol finder TMEM51
Protein Name transmembrane protein 51
RefSeq NM_018022.1
Length of RefSeq (bp) 1809
Chromosome 1p36.21
Reference DDBJ accession
UniGene Hs.465305

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBd62F03 pGCAP10 GGCGCTTCCTGCGTCCCCAACCCGGTCCCTGAGAGGGCACTGCGCCCTCTCCACCACTGC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl